algorithms imaris 9 3 1 bitplane n a imagej fiji n a cell reports 45 (Oxford Instruments)
Oxford Instruments is a verified supplier 
Oxford Instruments manufactures this product 
99
Structured Review
Oxford Instruments
algorithms imaris 9 3 1 bitplane n a imagej fiji n a cell reports 45
Algorithms Imaris 9 3 1 Bitplane N A Imagej Fiji N A Cell Reports 45, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 44244 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+imagej+n+a/Imaris/pm41447531-268-144-145
Average 99 stars, based on 44244 article reviews
Algorithms Imaris 9 3 1 Bitplane N A Imagej Fiji N A Cell Reports 45, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 44244 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+imagej+n+a/Imaris/pm41447531-268-144-145
Average 99 stars, based on 44244 article reviews
algorithms imaris 9 3 1 bitplane n a imagej fiji n a cell reports 45 - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Mutagenesis:Article Title: Spatiotemporally Controlled Myosin Relocalization and Internal Pressure Generate Sibling Cell Size Asymmetry Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological Samples Larval brain tissues from wild type and mutant Drosophila melanogaster strains This study N/A Chemicals, Peptides, and Recombinant Proteins Bovine Growth Serum Thermo Scientific Cat# SH3054102 Schneider’s Insect Medium Sigma-Aldrich Cat# S0146 Colcemid (MT inhibitor) Sigma-Aldrich Cat# D7385 Rho kinase inhibitor Y-27632 LClabs Cat# Y-5301 5-(N-Ethyl-N-isopropyl)amiloride (EIPA) Sigma-Aldrich Cat# A3085 Collagenase Type I Sigma-Aldrich Cat# C0130 Papain Sigma-Aldrich Cat# P4762 Chan and Gehring’s medium (Chan & Gehring 1971) Experimental Models: Organisms/strains D. melanogaster: pinsP89 (Yu et al. 2000) FBal0104444 D. melanogaster: pinsP62 (Yu et al. 2000) FBal0104445 D. melanogaster: rodH4.8 (Basto et al. 2000) FBal0014638 D. melanogaster: SqhAX3 (Jordan & Karess 1997) FBal0035707 D. melanogaster: worGal4, UAS-Cherry::Jupiter (Cabernard & Doe 2009) FBtp0040573 D. melanogaster: worGal4, UAS-Cherry::Jupiter, Sqh::GFP (Cabernard et al. 2010) FBtp0040573 D. melanogaster: Baz::GFP (Buszczak et al. 2007) D. melanogaster: worGal4, UAS-Cherry::Jupiter; Mira::GFP (Cabernard & Doe 2009) FBtp0041413 D. melanogaster: Sqh::GFP (Martin et al. 2009) FBrf0151365 D. melanogaster: UAS-Cnn::EGFP (Megraw et al. 2002) FBrf0152123 D. melanogaster: UAS-pH::EGFP Bloomington BDSC:39693 D. melanogaster: pUAST-attPPhyB::mCherry::CAAX This paper D. melanogaster: pUAST-attP-CAAX::VhhGFP4 This paper Oligonucleotides Forward primer for pUAST-attP-CAAX::VhhGFP4 AGGGAATTGGGAATTCCGCCACCATGGATCAA GTCCAACTGGTG This paper Reverse primer for pUAST-attP-CAAX::VhhGFP4 TCTTCTTTTTACGCGTGCTGGAGACGGTGACCT G This paper Forward primer for pUAST-attP-PhyB::mCherry:: CAAX GGGAATTGGGAATTCCGCCACCATGGTATCAG GTG This paper Reverse primer for pUAST-attP-PhyB::mCherry:: CAAX ACAAAGATCCTCTAGATTACATGATAACACACTT GGTTTTTG This paper Recombinant DNA pUAST-attB-CAAX::VhhGFP4 This paper pUAST-attB-PhyB::mCherry::CAAX This paper Software and Recombinant:Article Title: Spatiotemporally Controlled Myosin Relocalization and Internal Pressure Generate Sibling Cell Size Asymmetry Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological Samples Larval brain tissues from wild type and mutant Drosophila melanogaster strains This study N/A Chemicals, Peptides, and Recombinant Proteins Bovine Growth Serum Thermo Scientific Cat# SH3054102 Schneider’s Insect Medium Sigma-Aldrich Cat# S0146 Colcemid (MT inhibitor) Sigma-Aldrich Cat# D7385 Rho kinase inhibitor Y-27632 LClabs Cat# Y-5301 5-(N-Ethyl-N-isopropyl)amiloride (EIPA) Sigma-Aldrich Cat# A3085 Collagenase Type I Sigma-Aldrich Cat# C0130 Papain Sigma-Aldrich Cat# P4762 Chan and Gehring’s medium (Chan & Gehring 1971) Experimental Models: Organisms/strains D. melanogaster: pinsP89 (Yu et al. 2000) FBal0104444 D. melanogaster: pinsP62 (Yu et al. 2000) FBal0104445 D. melanogaster: rodH4.8 (Basto et al. 2000) FBal0014638 D. melanogaster: SqhAX3 (Jordan & Karess 1997) FBal0035707 D. melanogaster: worGal4, UAS-Cherry::Jupiter (Cabernard & Doe 2009) FBtp0040573 D. melanogaster: worGal4, UAS-Cherry::Jupiter, Sqh::GFP (Cabernard et al. 2010) FBtp0040573 D. melanogaster: Baz::GFP (Buszczak et al. 2007) D. melanogaster: worGal4, UAS-Cherry::Jupiter; Mira::GFP (Cabernard & Doe 2009) FBtp0041413 D. melanogaster: Sqh::GFP (Martin et al. 2009) FBrf0151365 D. melanogaster: UAS-Cnn::EGFP (Megraw et al. 2002) FBrf0152123 D. melanogaster: UAS-pH::EGFP Bloomington BDSC:39693 D. melanogaster: pUAST-attPPhyB::mCherry::CAAX This paper D. melanogaster: pUAST-attP-CAAX::VhhGFP4 This paper Oligonucleotides Forward primer for pUAST-attP-CAAX::VhhGFP4 AGGGAATTGGGAATTCCGCCACCATGGATCAA GTCCAACTGGTG This paper Reverse primer for pUAST-attP-CAAX::VhhGFP4 TCTTCTTTTTACGCGTGCTGGAGACGGTGACCT G This paper Forward primer for pUAST-attP-PhyB::mCherry:: CAAX GGGAATTGGGAATTCCGCCACCATGGTATCAG GTG This paper Reverse primer for pUAST-attP-PhyB::mCherry:: CAAX ACAAAGATCCTCTAGATTACATGATAACACACTT GGTTTTTG This paper Recombinant DNA pUAST-attB-CAAX::VhhGFP4 This paper pUAST-attB-PhyB::mCherry::CAAX This paper Software and Software:Article Title: Spatiotemporally Controlled Myosin Relocalization and Internal Pressure Generate Sibling Cell Size Asymmetry Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological Samples Larval brain tissues from wild type and mutant Drosophila melanogaster strains This study N/A Chemicals, Peptides, and Recombinant Proteins Bovine Growth Serum Thermo Scientific Cat# SH3054102 Schneider’s Insect Medium Sigma-Aldrich Cat# S0146 Colcemid (MT inhibitor) Sigma-Aldrich Cat# D7385 Rho kinase inhibitor Y-27632 LClabs Cat# Y-5301 5-(N-Ethyl-N-isopropyl)amiloride (EIPA) Sigma-Aldrich Cat# A3085 Collagenase Type I Sigma-Aldrich Cat# C0130 Papain Sigma-Aldrich Cat# P4762 Chan and Gehring’s medium (Chan & Gehring 1971) Experimental Models: Organisms/strains D. melanogaster: pinsP89 (Yu et al. 2000) FBal0104444 D. melanogaster: pinsP62 (Yu et al. 2000) FBal0104445 D. melanogaster: rodH4.8 (Basto et al. 2000) FBal0014638 D. melanogaster: SqhAX3 (Jordan & Karess 1997) FBal0035707 D. melanogaster: worGal4, UAS-Cherry::Jupiter (Cabernard & Doe 2009) FBtp0040573 D. melanogaster: worGal4, UAS-Cherry::Jupiter, Sqh::GFP (Cabernard et al. 2010) FBtp0040573 D. melanogaster: Baz::GFP (Buszczak et al. 2007) D. melanogaster: worGal4, UAS-Cherry::Jupiter; Mira::GFP (Cabernard & Doe 2009) FBtp0041413 D. melanogaster: Sqh::GFP (Martin et al. 2009) FBrf0151365 D. melanogaster: UAS-Cnn::EGFP (Megraw et al. 2002) FBrf0152123 D. melanogaster: UAS-pH::EGFP Bloomington BDSC:39693 D. melanogaster: pUAST-attPPhyB::mCherry::CAAX This paper D. melanogaster: pUAST-attP-CAAX::VhhGFP4 This paper Oligonucleotides Forward primer for pUAST-attP-CAAX::VhhGFP4 AGGGAATTGGGAATTCCGCCACCATGGATCAA GTCCAACTGGTG This paper Reverse primer for pUAST-attP-CAAX::VhhGFP4 TCTTCTTTTTACGCGTGCTGGAGACGGTGACCT G This paper Forward primer for pUAST-attP-PhyB::mCherry:: CAAX GGGAATTGGGAATTCCGCCACCATGGTATCAG GTG This paper Reverse primer for pUAST-attP-PhyB::mCherry:: CAAX ACAAAGATCCTCTAGATTACATGATAACACACTT GGTTTTTG This paper Recombinant DNA pUAST-attB-CAAX::VhhGFP4 This paper pUAST-attB-PhyB::mCherry::CAAX This paper Software and Article Title: Parallel Saltational Evolution of Ultrafast Movements in Snapping Shrimp Claws. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Biological Samples Complete list of species & sources in Table ST1 N/A N/A Chemicals, Peptides, and Recombinant Proteins Bouin’s solution Sigma-Aldrich HT10132 Iodine-potassium iodide solution ‘‘Jodtinktur Hetterich’’ Teofarma s.r.l. .. PZN: 3237398 Phosphotungstic acid Sigma-Aldrich 79690 Benzyl benzoate Sigma-Aldrich 68183 Benzyl alcohol Sigma-Aldrich 305197 Isopropanol Jodtinktur Hetterich W292907 Software and Article Title: Guidance by followers ensures long-range coordination of cell migration through α-catenin mechanoperception. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Images used in Figures Mendeley data https://dx.doi.org/10.17632/7ckg3p8d7d.1 Experimental models: Organisms/strains Zebrafish AB N/A N/A Zebrafish Tg(-1.8gsc:GFP)ml1 ZIRC ZDB-ALT-051004-2 Zebrafish Tg(tbx16:EGFP) Wells et al., 2011 ZDB-TGCONSTRCT-110722-1 Oligonucleotides Morpholino Vinculin a: CGTCTTGGTATGGAAAACTGGCATC Gene Tools This paper Morpholino Vinculin b: TGGAAAACCGGCATGATGATCGCTC Gene Tools This paper Morpholino Jupa (Plakoglobin 1a): GAGCCTCTCCCATGTGCATTTCCAT Gene Tools ZDB-MRPHLNO-091103-3 Morpholino Jupb (Plakoglobin 1b): CCTCACTCATTTGCAGTGACATCAC Gene Tools This paper Morpholino E-Cadherin: TAAATCGCAGCTCTTCCTTCCAACG Gene Tools ZDB-MRPHLNO-050421-2 Morpholino a-Catenin: TAATGCTCGTCATGTTCCAAATTGC Gene Tools ZDB-MRPHLNO-120206-2 Morpholino Sox32: CAGGGAGCATCCGGTCGAGATACAT Gene Tools ZDB-MRPHLNO-051216-6 Morpholino standard control: CCTCTTACCTCAGTTACAATTTATA Gene Tools N/A pCS2+ Histone2B-mCerulean Megason lab N/A pCS2+ Histone2B-mCherry Peyrieras lab N/A pCS2+ Lifeact-mCherry Addgene 185408 pSP64T acvr1ba* Addgene 185409 pCS2+ Dsh-DEP+ Mayor lab N/A pCS2+ Rac1N17 Symes lab N/A pCS2+ PH-GFP Raz lab N/A Zf cdh1-GFP Raz lab N/A pCS2+ Zf cdh1-Dcyto-GFP Addgene 185412 pCS2+ Zf ctnna1 de Rooij lab N/A pCS2+ Zf ctnna1-GFP de Rooij lab N/A pCS2+ Zf ctnna1-DVBS de Rooij lab N/A pCS2+ Zf ctnna1L344P Addgene 185407 pCS2+ Zf GFP-vcla Addgene 185410 pCS2+ Zf GFP-vclb Addgene 185411 pBS-IISK+ gsc Bally-Cuif lab N/A pBS-IISK+ tbxta Thisse lab N/A pBS-IISK+ ctslb ZIRC ZDB-EST-010914-13 Antibodies a-Catenin Sigma-Aldrich Cat# C2081; RRID: AB_476830 a-Tubulin DM1a Cell Signaling Technology Cat# 3873; RRID: AB_1904178 E-Cadherin BD Biosciences Cat# 610181; RRID: AB_397580 Plakoglobin BD Biosciences Cat# 610253; RRID: AB_397648 Vinculin Sigma-Aldrich Cat# V9131; RRID: AB_477629 (Continued on next page) Developmental Cell 57, 1529–1544.e1–e5, June 20, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER IRDye 680RD Goat anti-Rabbit IgG Li-Cor Biosciences Cat# 925-68071; RRID: AB_2721181 IRDye 800CW Goat anti-Mouse IgG Li-Cor Biosciences Cat# 925-32210; RRID: AB_2687825 Software and Imaging:Article Title: Spatiotemporally Controlled Myosin Relocalization and Internal Pressure Generate Sibling Cell Size Asymmetry Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological Samples Larval brain tissues from wild type and mutant Drosophila melanogaster strains This study N/A Chemicals, Peptides, and Recombinant Proteins Bovine Growth Serum Thermo Scientific Cat# SH3054102 Schneider’s Insect Medium Sigma-Aldrich Cat# S0146 Colcemid (MT inhibitor) Sigma-Aldrich Cat# D7385 Rho kinase inhibitor Y-27632 LClabs Cat# Y-5301 5-(N-Ethyl-N-isopropyl)amiloride (EIPA) Sigma-Aldrich Cat# A3085 Collagenase Type I Sigma-Aldrich Cat# C0130 Papain Sigma-Aldrich Cat# P4762 Chan and Gehring’s medium (Chan & Gehring 1971) Experimental Models: Organisms/strains D. melanogaster: pinsP89 (Yu et al. 2000) FBal0104444 D. melanogaster: pinsP62 (Yu et al. 2000) FBal0104445 D. melanogaster: rodH4.8 (Basto et al. 2000) FBal0014638 D. melanogaster: SqhAX3 (Jordan & Karess 1997) FBal0035707 D. melanogaster: worGal4, UAS-Cherry::Jupiter (Cabernard & Doe 2009) FBtp0040573 D. melanogaster: worGal4, UAS-Cherry::Jupiter, Sqh::GFP (Cabernard et al. 2010) FBtp0040573 D. melanogaster: Baz::GFP (Buszczak et al. 2007) D. melanogaster: worGal4, UAS-Cherry::Jupiter; Mira::GFP (Cabernard & Doe 2009) FBtp0041413 D. melanogaster: Sqh::GFP (Martin et al. 2009) FBrf0151365 D. melanogaster: UAS-Cnn::EGFP (Megraw et al. 2002) FBrf0152123 D. melanogaster: UAS-pH::EGFP Bloomington BDSC:39693 D. melanogaster: pUAST-attPPhyB::mCherry::CAAX This paper D. melanogaster: pUAST-attP-CAAX::VhhGFP4 This paper Oligonucleotides Forward primer for pUAST-attP-CAAX::VhhGFP4 AGGGAATTGGGAATTCCGCCACCATGGATCAA GTCCAACTGGTG This paper Reverse primer for pUAST-attP-CAAX::VhhGFP4 TCTTCTTTTTACGCGTGCTGGAGACGGTGACCT G This paper Forward primer for pUAST-attP-PhyB::mCherry:: CAAX GGGAATTGGGAATTCCGCCACCATGGTATCAG GTG This paper Reverse primer for pUAST-attP-PhyB::mCherry:: CAAX ACAAAGATCCTCTAGATTACATGATAACACACTT GGTTTTTG This paper Recombinant DNA pUAST-attB-CAAX::VhhGFP4 This paper pUAST-attB-PhyB::mCherry::CAAX This paper Software and other:Article Title: Expanding Actin Rings Zipper the Mouse Embryo for Blastocyst Formation. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER siRNA targeting sequence: a-catenin Catna1 #6: CTGGTAAACACCAATAGTAAA QIAGEN SI02711688 siRNA targeting sequence: Myosin II Myh9 #1: CAGGGCTTATCTACACCTATT QIAGEN SI01321411 siRNA targeting sequence: Myosin II Myh9 #3: TCCAGCAAGAATGGCTTTGAA QIAGEN SI01321425 siRNA targeting sequence: ZO1 Tjp1 #6: TAGG AGATTCATTCTATATTA QIAGEN SI02688896 siRNA targeting sequence: ZO1 Tjp1 #8: CTGA ATCTATAAATTAACATA QIAGEN SI02735236 siRNA targeting sequence: Ezrin Vil2 #4: CCAG TTTAAATTCCGGGCCAA QIAGEN SI00185437 siRNA targeting sequence: Ezrin Vil2 #5: GAGG ATAGTATTTATATATAA QIAGEN SI02669163 AllStars negative control siRNA: Sequence undisclosed by QIAGEN QIAGEN SI03650318 Recombinant DNA GFP-MAP2c Michel Bornens N/A RFP-MAP2c Michel Bornens N/A GFP-UtrCH Addgene 26737 RFP-UtrCH Addgene 26739 H2B-GFP This study N/A H2B-RFP Addgene 53745 GFP-actin James Nelson N/A paGFP-actin James Nelson N/A GFP-Pard6b (Alarcon, 2010) N/A EB3-dTomato Addgene 50708 E-cad-GFP Alpha Yap N/A E-cadDICD-GFP (Samarage et al., 2015) N/A GFP-a-catenin Addgene 20139 GFP-MyoII Addgene 11347 GFP-ZO1 Addgene 30313 Ezrin-GFP Addgene 20680 Ezrin-mRuby2 This study N/A PLEKHA7-GFP (Meng et al., 2008) N/A 2G4-GFP (Cassimeris et al., 2013) N/A Occludin-Emerald Addgene 54212 Lck-GFP Addgene 61099 Lifeact-GFP (Riedl et al., 2008) N/A Emerald-Fascin Addgene 54094 Software and Algorithms ImageJ N/A https://imagej.nih.gov/ij/ |